It is well-known that butyrate benefit for intestine hemostasis. Currently few determination methods for butyrate in bio-samples are available. Some methods are time-consuming and depend on expensive analytical instruments (such as GC-MS method). It is necessary to develop a new sensitive and quick method for butyrate assay. The biological experiment section of this project supplies a butyrate microbial sensor for butyrate quantification. The plasmid with butyrate recognizing promoter, pchA, pLEE promoter and red fluorescent protein gene were constructed and then inserted into E coli to make butyrate microbial sensor. The details were described in the following experimental procedure.

LB liquid medium was prepared by 1% NaCl, 1% peptone, 0.5% Yeast extract and deionized water. LB solid medium was prepared by 1% NaCl, 1% peptone, 0.5% yeast extract, 1.5% agarose and deionized water. Above medium were sterilized at 121℃ for 20 min. The LB liquid medium was kept in 4℃. When the solid medium cooled to 60℃, Ampicillin (Amp) was added into the solid medium in clean bench. After mixing, the LB solid medium was poured into petrie dish and were kept in 4℃ after solidifying.

2.1 Transformation

5 μL of empty plasmid (empty plasmid PUC57, Sango Biotech Company, Shanghai, China) was added into centrifuge tube with 50 μL of DH5α in clean bench. After mixing, the centrifuge tube was put on ice for 30 min and then was heated in 42℃ water bath for 90 s. After that, the tube was put on ice for 2 min and 500 μL of LB liquid medium was added. Then the tube was cultured at 37℃ shaker oscillator for 1 h. The 100 μL of bacteria suspension was coated on the LB solid medium. The solid medium was cultured at 37℃ for 12h. Single colonies were picked into LB liquid medium (containing 1‰ Amp). The bacterial fluid was cultured at 37℃ oscillator for 12 h.

2.2 Preservation of plasmid and bacteria

700 μL of bacteria suspension and 700 μL of glycerol was added into 1.5 mL EP tubes in clean bench. After thorough mixing, the bacteria were preserved. 2 mL of bacteria suspension was centrifugated at 12000 rpm for extracting empty plasmid.

2.3 Plasmid extraction

The TIANprep Mini Plasmid Kit (Cat. no. 4992423/4992420, TIANGEN Biotech, Beijing, China) was used for extracting plasmid. The extraction process followed the TIANprep Mini Plasmid Kit Handbook (https://www.tiangen.com/content/details_40_16610.html). The main extraction steps included balance of absorption column CP3, RNA removal, bacterial lysis, protein removal, rinse and plasmid collection. Finally, the empty plasmid was collected.

2.4 Agarose gel electrophoresis

The agarose gel electrophoresis was used for verify the plasmid size. The operation steps of agarose gel electrophoresis referred to the Book-《synthetic biology》(Science Press, First Edition, February 2010). After the samples and marker Ⅲ DNA Ladder (Marker Ⅲ DNA Ladder, Beijing Solarbio Tech Ltd Corp) were added to the corresponding loading well, the electrophoresis started (DYCP-31E Agarose electrophoresis instrument, Beijing Liuyi BioTech Ltd Corp, Beijing, China). The voltage was set at 110 V and the electrophoresis was run for 35 min. Then the gel was observed in Bio-Rad ChemiDoc XRS+ Chemiluminescence Imaging System (Bio-Rad, CA, US).

Table 2: Reaction system

Mix	Volume
Taq PCR Mix (2x)	25 μL
Primer Mix	2 μL
Template	2 μL
ddH2O	21 μL

3.1 The amplification of mRFP gene

The primers of mRFP (shown in Table 1) were synthesized by Sango Biotech Company, Shanghai, China. The reaction system and program were listed in Table 2 and 3.

Table 1: The primers of mRFP

Gene Name	Primer	5′-3′ sequence
RFP	up	GTTTCTTCGAATTCGCGGCCGCTTCTAGAGATGGC TTCCTCCGAAGACGT
	down	GTTTCTTCCTGCAGCGGCCGCTACTAGTATTAAGC ACCGGTGGAGTGAC

Table 2: Reaction system

Mix	Volume
Taq PCR Mix (2x)	25 μL
Primer Mix	2 μL
Template	2 μL
ddH2O	21 μL

Table 3: PCR proceeding

Process	Temperature (°C)	Time
Predenaturation	95	2.5 min
Denaturation	95	15 s
Annealing	63	30 s
Extension	72	11 min

3.2 Enzyme-cut

The Enzyme-cut system of plasmid and target gene was listed in Table 4. The PCR tube was mixed and kept at 37 ℃ for 3 h.

Table 4: The Enzyme-cut system of plasmid and target gene

Enzyme-cut system of plasmid		Enzyme-cut system of target gene
Plasmid	10 μL	Target gene
Buffer	2 μL	Buffer
EcoRI	0.5 μL	EcoRI
XbaI	0.5 μL	SpeI
ddH2O	7 μL	ddH2O

3.3 Agarose gel electrophoresis

The agarose gel electrophoresis method was used for verify whether the enzyme-cut was successful. The process was the same as the Section 2(4).

3.4 Gel extraction

The target gel was cut and put into the 1.5 mL of tube and melted in 75 ℃ water bath. The TIANgel Midi Purification Kit was used for gel extraction. The operation was conducted by the instruction (https://www.tiangen.com/content/details_40_21362.html). Briefly, the main procedure included melting gel, gel recovery, desalination and gel recovery again. Finally, the target gene was obtained.

3.5 Genes linked by enzyme

The Enzyme-linked system in Table 5 was used. The system was mixed and kept at room temperature for 24 h. After empty plasmid and mRFP gene were linked, the new plasmid (marked as the Plasmid Ⅰ) was obtained.

Table 5: Enzyme-linked system for Plasmid I

Mix	Volume
5× buffer	2 μL
T4 DNA Ligase	0.4 μL
Plasmid	2 μL
mRFP gene	6 μL

3.6 Transformation
The above Plasmid Ⅰ was transformed into bacteria as the Section 2.1.

3.7 Preservation of Plasmid I and bacteria

The method was conducted as the Section 2.2. The Plasmid Ⅰ and bacteria were kept at -80℃.

3.8 Verification of plasmid size

The size of Plasmid I was verified following the method for plasmid extraction (Section 2.2) and agarose gel electrophoresis (Section 2.3).

4.1 The amplification of pLEE gene

The primers of pLEE (shown in Table 6) were synthesized by Sango Biotech Company, Shanghai, China. The reaction system and program were listed in Table 2 and 3. The reaction system and PCR process were almost the same as the Section 3.1. The only difference was that the number of primers were 1μL and the annealing temperature was 63℃. Finally, the target gene was obtained.

Table 6: The primers of pLEE

Gene Name	Primer	5′-3′ sequence
pLEE	up	GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTTAAC GAGATGATTTTCTTC
	down	GTTTCTTCCTGCAGCGGCCGCTACTAGTAAAGCTGA ATGTMATGGACTTG

4.2 Enzyme-cut, agarose gel electrophoresis and gel extraction

The enzyme-cut system was the same as the Section 3.2. The agarose gel electrophoresis method was used for verify whether the enzyme-cut was successful. The process was the same as the section 2.4. The process of gel extraction was the same as the Section 3.4.

4.3 Genes linked by enzyme

The Enzyme-linked system in Table 7 was used. The system was mixed and kept at room temperature for 24 h. After Plasmid I and pLEE gene were linked, the new plasmid (marked as the Plasmid Ⅰ) was obtained.

Table 7: Enzyme-linked system for Plasmid II

Mix	Volume
5× buffer	2 μL
T4 DNA Ligase	0.4 μL
Plasmid I	1.3 μL
pLEE gene	6.7 μL

4.4 Transformation and preservation of plasmid and bacteria

The Plasmid Ⅱ was transformed into bacteria as the Section 2.1. The process was conducted as the Section 2.2. The method was conducted as the Section 2.2. The Plasmid II and bacteria were kept at -80℃.

5.1 The amplification of pPchA and PchA gene

The primers of pPchA and PchA (shown in Table 8) were synthesized by Sango Biotech Company, Shanghai, China. The reaction system and program were listed in Table 2 and 3. The reaction system and PCR process were almost the same as the Section 3.1. The difference was that the primer mix to template was 1:7 and the annealing temperature was 65℃. Finally, the target gene was obtained.

Table 8: The primers of pPchA and PchA

Gene Name	Primer	5′-3′ sequence
pPchA and PchA	up	GTTTCTTCGAATTCGCGGCCGCTTCTAGAGCAC AGGAATATATCCGTACC
	down	GTTTCTTCCTGCAGCGGCCGCTACTAGTATTA GCATTTTTTTGACCGCG

5.2 Enzyme-cut, agarose gel electrophoresis and gel extraction

The enzyme-cut system was the same as the Section 3.2. The agarose gel electrophoresis method was used for verify whether the enzyme-cut was successful. The process was the same as the section 2.4. The process of gel extraction was the same as the Section 3.4.

5.3 Genes linked by enzyme

The Enzyme-linked system in Table 9 was used. The system was mixed and kept at room temperature for 24 h. After Plasmid II and pPchA and PchA gene were linked, the new plasmid (marked as the Plasmid ⅠII) was obtained.

Table 9: Enzyme-linked system for Plasmid III

Mix	Volume
5× buffer	2 μL
T4 DNA Ligase	0.4 μL
Plasmid III	1 μL
pPchA and PchA gene	7 μL

5.4 Transformation and preservation of plasmid and bacteria

The Plasmid Ⅱ was transformed into bacteria as the Section 2.1. The process was conducted as the Section 2.2. The method was conducted as the Section 2.2. The Plasmid III and bacteria were kept at -80℃.

5.5 Validation of genetically engineered bacteria

The 180 μL of engineering bacteria solution at logarithmic phase was added into 96-well plate and cultured at 37℃. A series of known concentrations of sodium butyrate standard solutions were prepared. 20 μL of each standard solution was added into the well with the final concertation of 5, 10, 20, 40, 60 mM. After incubating at 37℃ for 30 min, the fluorescence intensity was recorded by Biotek Cytoation5 Cell Imaging Microporous Plate Detector (Instrument BioTek Bergen, USA). The fluorescence intensity (Y) was then subjected to linear regression analysis with sodium butyrate concentration (X).

6.1 According to the above experimental sections, plasmid extraction and agarose gel electrophoresis were performed on the plasmid III. It was detected that the size of plasmid III was approximately 4500bp, which was in line with the expected size (Figure 1, the successful lanes). Finally, the Plasmid III was usefully constructed. The plasmid profile was shown in Figure 2.

During the experiments, some experimental conditions should be addressed. The heat shock time was set as 90 sec to increase the transformation efficiency. During PCR experiment for pLEE gene, when the annealing temperature was set at 62 ℃, but there were many unexpected bands in gel electrophoresis map. When the annealing temperature was increased to 62 ℃ and the primer concentration was reduced, good results were obtained. Enzyme cut time was extended, to ensure sufficient enzyme cut. We have found it was more difficult to link pLEE gene and the ratio of plasmid to gene was increased t 1:5, better result was acquired.