Best Basic P

Lumbrokinase (NCBI AY187629)

Part name: BBa_K4673017

Part type: Basic, DNA

Lumbrokinase is a type of protein that is derived from Lumbricus bimastus and belongs to the group of serine proteases that plays an important role in the degradation of fibrin. In addition, Lumbrokinase promotes the fibrinolytic system, which is an important component of thrombus removal. In the blood, plasmin normally exists in the form of plasminogen that is hydrolyzed into plasmin by a plasminogen activator called t-PA, thereby breaking down fibrin (Lawrence, 2011).

In blood vessels, fibrinogen is a plasma protein that is converted to fibrin by thrombin gathering substances such as platelets and erythrocyte to form thrombus (Lin et al., 2020). Thus, according to the formation principle of the thrombus and the fibrinolytic system, if Lumbrokinase can effectively degrade fibrinogen and fibrin and disrupt the structure of the thrombus, the blockage can be removed.

There are three main mechanisms of how Lumbrokinase removes the thrombus:

  • Directly dissolves fibrinogen and fibrin in the blood vessels so that the thrombus will not be produced
  • Promotes t-PA (endogenous tissue plasminogen activator) to produce plasmin, further destroying the thrombus (Miszta et al., 2021)
  • Inhibits the collective activation of platelets

Moreover, Lumbrokinase has been demonstrated to function under a multicenter, randomized, parallel-group, open label and controlled clinical trial without adversely affecting the coagulation system (CAO et al., 2013). The article provides evidence that Lumbrokinase has great prospects for development and it is a source of inspiration for our team to study more about Lumbrokinase.

In our team’s project, the pivotal contribution of the Lumbrokinase gene in our project lies in its ability to be translated into functional Lumbrokinase, a potent enzyme that serves a crucial function in thrombus dissolution. In addition, the Lumbrokinase gene will be induced through two mechanisms of IPTG induction and oleate induction, thereby expressing Lumbrokinase for our two goals: improving industrial production and creating a probiotic platform, respectively.

The source of the part:

The Lumbrokinase gene was produced and amplified by PCR during the experimental procedures by team Taipei_KCISLK_V1 in the lab.

Design considerations: (757 bp)

During our experiment, the Lumbrokinase gene was inserted into both the pGEM-T EASY vector and the pET-22b-LK vector using the approach called TA cloning. It is located between 65BamHI and 810Xhol in the pGEM-T EASY vector and inserted between the pelB signal sequence and 6X his-tag in the pET-22b-LK vector.

5-GAACTTCCTCCCGGAACAAAAATTGTCGGAGGAATTGAAGCTAGACCATACGAGTTCCCATGGCAGGTGTCCGTCCGAAGGAAGTCTTCCGATTCCCATTTCTGCGGAGGTAGCATCATCAACGATCGTTGGGTTGTCTGCGCTGCTCACTGCATGCAGGGAGAGGCCCCCGCTCTGGTTTCATTGGTCGTGGGTGAGCACGACAGGAGTGCAGCGAGTACAGTACGTCAGACTCATGACGTTGATAGCATCTTCGTTCACGAGGACTACAACACAAATACCCTAGAGAACGACGTTTCTGTCATCAAGACATCTGTTGCCATCACTTTCGACATCAACGTTGGTCCAATCTGCGCCCCAGATCCAGCCAACGACTACGTCTACCGTAAGAGCCAGTGCTCCGGATGGGGAACTATCAATTCAGGTGGAATCTGCTGTCCCAACATTCTGCGATACGTGACGCTGAATGTCACAACCAACCAATTCTGCGAAGATGTATACCCACTAAATTCAATCTACGACGATATGATTTGCGCGTCGGACAACACTGGGGGTAACGACAGAGACTCCTGCCAGGGTGACTCCGGCGGCCCTCTGAGCGTCAAGGATGGCAGTGGAATCTTCAGCCTGATTGGTATTGTGTCTTGGGGAATTGGTTGCGCTTCTGGCTATCCAGGAGTCTACTCCCGCGTCGGATTCCATGCTGCATGGATCACCGACATCATCACCAACAAC

References:

CAO, Y., ZHANG, X., WANG, W., ZHAI, W., QIAN , J., WANG , J., CHEN, J., YOU, N., ZHAO, Z., WU, Q., XU, Y., YUAN, L., LI , R., & LIU, C. (2013). Oral fibrinogen-depleting agent lumbrokinase for secondary ischemic stroke prevention: results from a multicenter, randomized, parallel-group and controlled clinical trial. 4060–4065.s

Xu, Z., Yang, Y., Gui, Q., Zhang, L., & Hu, L. (2009). Expression, purification, and characterization of recombinant lumbrokinase PI239 in Escherichia coli.