Updated on 2023-11-5: we won the Best Environment Project (Undergrad) (opens new window).

Updated on 2023-10-20: our presentation video is live at https://video.igem.org/w/xt8EbkjhMVRkZ1iULupnj9 (opens new window).

Overview

To expand humanity's horizons beyond Earth, our project, named Biofilm Harnessing for Offworld Mankind Establishment (B.HOME), has raised a groundbreaking approach to terraforming, transforming barren rocks on terrestrial planets in fertile soil. Drawing inspiration from the pioneer plants of lichens, we have developed an ecological biofilm with the symbiotic relationship between cyanobacteria and Escherichia coli (E. coli). We integrated four interconnected systems into our biofilm: Survival, Symbiotic, Biofilm Formation, and Terraforming Systems. Through these systems, we have engineered an ecological biofilm with remarkable resilience, autotrophic survival capabilities, structural integrity, and terraforming functionality.

Figure 1: Systems Overview
B.HOME is composed of four interconnected systems: Survival, Symbiotic, Biofilm Formation, and Terraforming Systems

1. Survival System

In the Survival System, we introduced Anti-UV Module, Anti-Freeze Module and Anti-Desiccation Module to arm our biofilm with the necessary adaptability against inhospitable conditions.

Anti-UV Module

In the Anti-UV module, we introduced various DNA repair or binding proteins (FEN1, XRCC1, and Hypsibius exemplaris mtSSB) (sequence details and functional characterization in BBa_K4765018 (opens new window), BBa_K4765019 (opens new window), and BBa_K4765016 (opens new window)) and MAA producing enzymes (MysA/B/C/D/H, details in Part:BBa_K4765118 (opens new window)) that regulate UV-absorbing substances to enhance E. coli's resistance to UV radiation.

We employed the Colony-Forming Unit (CFU) assay. After plasmid transformation and plating, we shielded half of the agar plate from UV light using a black paperboard, while the other half was exposed to UV irradiation (6W power) with combined wavelengths of 254 nm and 365 nm for 10 seconds.

Figure 2: Anti-UV Assay
After plating, half of the plate is exposed to UV radiation. In the initial phase of assay development, we tried to shield the place with a smaller paperboard (shown on the right). We found the boundary of UV vs not-irradiated is not clear, and there is no need to try smaller paperboard. For CFU, it is better to UV the entire plate or not, to avoid counting confusion at the boundary.

Our experimental results demonstrated that most DNA repair and binding proteins exhibited a higher survival rate compared to plain E. coli, indicating improved anti-UV tolerance, especially XRCC1 and FEN1. We hypothesized that these proteins function by aiding in DNA repair or binding to DNA, thus shielding chromatin from hydroxyl radicals induced by UV radiation. Interestingly, we observed that the expression of green fluorescence stayGold (BBa_K4162001) (opens new window) in E. coli, intended as a negative control, significantly increased the survival rate. We suspected that this effect may be due to fluorescent protein absorbing a certain amount of UV radiation through structural changes.

Figure 3: Survival Rate after UV Exposure
Percentage of viable E. coli expressing proteins following UV radiation exposure
(Note: The quantitative graph is based on the whole plate CFU to avoid the blurriness at the boundaries of the paperboard-shielded area from UV.)

Anti-Freeze Module

AnAFP (details in BBa_K4765015 (opens new window)) is an anti-freeze protein derived from Ammopiptanthus nanus, we heterologously expressed AnAFP in E. coli, endowing the bacteria with anti-freeze capability.

To test the anti-freeze capability of AnAFP, we subjected E. coli expressing AnAFP to cold treatment at 0°C. Bacteria were placed on iced water, maintained in cold room, and samples were collected after 0, 24, 48, and 96 hours for CFU counting, and a survival rate curve was plotted. We did not use -30 or -80 degrees for testing, because E. coli stock is usually kept at those temperatures where bacteria can survive for years. Surviving at 0 degree would be very challenging for bacteria. We did not test the number of freeze-thawn cycles our bacteria could survive.

Figure 4: AnAFP Antifreeze Assay
CFU counting is performed at 0,24,48,96 hours under during treatment.

As shown in the following figure, E. coli expressing AnAFP exhibited a higher survival rate under prolonged cold treatment conditions compared to E. coli transformed with an empty pET28 vector, indicating that AnAFP expressing enables bacteria to possess anti-freeze ability, surviving at 0 degree for extended time.

Figure 5: Survival Curves under Cold Treatment at 0°C
In the initial 48 hours, there was no significant difference in the survival rates between the experimental and control groups. However, after 48 hours, the survival rate of the experimental group was significantly higher than that of the control group.

Anti-Desiccation Module

H. ex mtSSB (details in BBa_K4765016 (opens new window)) is a type of mitochondrial single-stranded DNA binding protein, it can prevent DNA damage during genotoxic stress.

In Anti-Desiccation Module, we tested the anti-desiccation capability of E. coli expressing mtSSB alone, or co-expressing mtSSB, AnAFP and another TDP protein SAHS 33020 (opens new window). Experiment was conducted as following: we centrifuged the liquid culture of the experimental groups, and removed the supernatant. Pellets are dried for 6.5 hr in SpeedVac under 4°C .Finally, the pellets are weighed and resuspended in LB medium and diluted 10⁵-fold for CFU counting.

Figure 6: Desiccation Survival Assay
CFU counting is performed after dried in SppedVac for 6.5 hours.

As shown below, we observed that H. ex mtSSB has a comparable anti-desiccation capability with SAHS 33020. When both H. ex mtSSB and SAHS 33020 are co-expressed, E. coli exhibits a higher survival rate under desiccation compared to E. coli expressing these two proteins individually. Furthermore, altering the order of these three proteins in ribozyme-assistant polycistronic expression plasmid does not affect the survival rate of E. coli.

Figure 7: CFU colony Count of All the Groups after Drying
The E. coli expressing H.ex mtSSB, SAHS 33020 and AnAFP together showed higher CFU counts after drying compared to E.coli expresssing H. ex mtSSB and SAHS33020 individually. Futhermore there's no significant difference between the two E. colis with rearranged CDS positions. Mean values from three rounds of indepdent experiments are shown. Huge error bars suggest variations between rounds of experiments.

2. Symbiotic System

In the symbiotic system, we adopted the approach from the ShanghaiTech iGEM 2022 (opens new window) project, wherein we introduced the fructofuranosidase enzyme (SacC) (details in BBa_K4115017 (opens new window)) into E. coli to promote the hydrolysis of sucrose into fructose and glucose, enabling E. coli to sefficiently utilize sucrose as a carbon source.

We measure the growth curve through measuring optical density at a wavelength of 600 nm (OD₆₀₀).

Figure 8: Growth Curve Assay
Cultured sucrose-utilizing (SacC) and plain E. coli in nutrient-supplemented M9 medium to measure the growth curve by tracking OD₆₀₀.

Our experimental findings demonstrated that all bacterial groups reached a growth plateau approximately 7.5 hours. Notably, E. coli expressing SacC exhibited similar growth patterns to empty E. coli using glucose, indicating their effective utilization of sucrose.

During the experiment's progression, we observed a slight decrease in growth curves across all groups after reaching their peak, with OD₆₀₀ remaining below 0.2. To investigate this phenomenon, we hypothesized that after a couple of hours E. coli might lack specific growth factors to support further growth.

To pinpoint the limiting factors, we conducted a follow-up experiment at the 25-hour mark, isolating several tubes from empty E. coli cultures supplemented with carbon source, CaCl₂ or MgSO₄. Our results indicated that the growth curve notably improved upon the addition of MgSO₄, suggesting that MgSO4 was the limiting growth factor.

Figure 9: Growth Curve of SacC Experiments
Growth Curve of E. coli in M9 minimal medium with carbon source and extra nutrient factor

3. Biofilm Formation System

We've designed a biofilm formation system with two key components. The first involves surface displaying Antigen/Nanobody (Ag/Nb) through intimin to mediate the binding between E. coli strains. The second utilizes initimin-lectin fusion to facilitate the binding between E. coli and cyanobacteria.

E. coli - E. coli Binding

To confirm biofilm formation through intimin-Ag/Nb, we employed both aggregation experiments and fluorescence microscopy imaging to demonstrate its ability to mediate biofilm formation.

In the aggregation experiments, We combined cultures of E. coli expressing intimin-Ag1/Nb1, intimin-Ag2/Nb2 and intimin-Ag3/Nb3, and allowed them to settle. We measured the OD₆₀₀ of the supernatant at 0, 3, 6 hours to reflect the bacteria quantity remaining in the supernatant (details in BBa_K4765106 (opens new window))

Figure 10: Aggregation Assay Using Optical Density (OD₆₀₀) Measurements
The OD values of the cultures were standardized using LB KanR medium. OD~600~ 1 is equivilant to 10^8^ bacterial particles per mL.

We observed that at 3 hours, in the aTc-induced E. coli samples, bacteria percentage remaining in the supernatant was significantly lower compared to the uninduced samples. This indicates that the intimin-Ag/Nb pairs can effectively promote the binding between E. coli.

Figure 11: Bacteria Percentage Remaining in the Supernatant at the 3rd Hour
The bacterial quantity in the supernatant is quantified by OD₆₀₀(1 OD₆₀₀ corresponds to 10⁸ bacterial particles).

We also employed microscopy imaging to observe the growth and expansion of biofilm. Glass slides were treated with PDL (Poly-D-Lysine) for 10 seconds, followed by mixing E. coli expressing intimin-Ag3 (BBa_K4765105 (opens new window)) and intimin-Nb3 + mScarlet (BBa_K4765133 (opens new window)) on these slides. After several washes with LB KanR medium, 500 μL of LB KanR medium was added. The location of the founder cell was determined, and imaging was initiated on the microscope stage at 25°C, capturing photographs at 0, 2, and 5.5 hours or time-laspse with 5-minute interval. A bacterial lawn covering the field at the end of image.

Figure 12: Visualization of Biofilm Formation Using Fluorescence Microscopy Imaging
The glass slides were treated with Poly-L-Lysine for 10 seconds before cell mixing.

As illustrated in the following figure, the presence of Ag/Nb pairs on the surface enables two different strains of bacteria to coexist harmoniously by attaching to each other in an appropriate ratio. This coexistence is evident even at 5.5 hours, as both strains of bacteria remain within the field of view.

Figure 13: Biofilm Growth at 0, 2, and 5.5 Hours
Brightfield and fluorescence images were captured under a 150x objective lens.

In the video that follows, we present additional evidence of bacterial growth and division within our biofilm, where bacteria bound by Ag/Nb pairs can be observed continuously dividing. The fluorescent cells in the video consistently undergo cell division throughout the entire recording.

Figure 14: Visualization of Biofilm Formation through Microscopy Imaging
Magnification: 150x
Fluoresence images were captured with 5-minute interval. Comparing the starting and ending brightfield images, several bacteria grow into a bacterial lawn in about 8 hours.

These results collectively demonstrate that intimin-Ag/Nb fusion can mediate specific binding between E. coli and effectively promote biofilm formation.

Cyanobacteria - E. coli

To confirm the binding between cyanobacteria and E. coli, we mixed E. coli strains displaying lectins on their surfaces with the corresponding cyanobacteria and allowed them to settle. We measured the OD₆₀₀,₆₈₅ of the supernatant at 0, 2, 6, and 24 hours to assess the remaining E.coli / cyanobacteria in the supernatant (details in BBa_K4765109 (opens new window), BBa_K4765110 (opens new window))

Figure 15: Aggregation Assay Using Optical Density (OD_{600, 685}) Measurements
The OD values of the cultures were standardized using CoBG-11 medium

As shown below, we observed that after 6 hours, in both aTc-induced E. coli / cyanobacteria samples, bacteria percentage of bacteria remaining in the supernatant was significantly lower compared to the uninduced samples. This suggests that intimin-lectin can mediate the specific binding between E. coli and cyanobacteria, thereby accelerating the aggregation process.

Figure 16: Bacteria Percentage Remaining in the Supernatant 6h after Mixation
A: intimin-LCA E.coli / Synechococcus elongatus B: intimin-MVN E.coli / Microcystis aeruginosa
The bacterial quantity in the supernatant is quantified by OD₆₀₀ and OD₆₈₅.

For aTc-induced intimin-MVN E.coli / Microcystis aeruginosa mixed samples, while the final number of bacteria remaining in the supernatant showed no significant difference compared to the uninduced bacteria. However, the bacterial count at 2 hours and 6 hours was significantly lower than the uninduced bacteria, suggesting that the introduction of lectins contributes to aggregation process.

For aTc-induced intimin-LCA E.coli / Synechococcus elongatus mixed samples, the number of bacteria remaining in the supernatant at 2 hours showed no significant difference compared to the uninduced bacteria. Still, the bacterial count at 6 hours and 24 hours was significantly lower than the uninduced bacteria.

The differences in sedimentation patterns may arise from variations in cyanobacterial species and differences in the affinity of adhesins. Nonetheless, these observations support the idea that expressing intimin-lectin in E.coli can mediate the specific binding between E.coli and cyanobacteria, thereby promoting biofilm formation process.

Figure 17: Bacteria Remaining in the Supernatant at 0,2,6,24 Hours
A: intimin-LCA E.coli / Synechococcus elongatus B: intimin-MVN E.coli / Microcystis aeruginosa
The bacterial quantity in the supernatant is quantified by OD₆₀₀ (1 OD₆₀₀ corresponds to 10⁸ bacterial particles)

4. Terraforming System

EPS Module

To validate the adhesion effects of EPS (details in BBa_K4765121 (opens new window) and BBa_K4765122 (opens new window)), we performed microscopy imaging using a chamber-based approach. After mixing the E.coli expressing EPS with bacteria only expressing stayGold, it was forcefully pipetted ten times before loading into the flow chamber. Subsequently, we conducted fluorescence microscopy imaging. We applied two different force on culture media to wash the flow chamber with different speed, and observed whether the EPS-expressing E.coli could remain adhered to the glass surface.

Figure 18: Schematic of the Flow Chamber Device for EPS Experiments
This figure illustrates the setup of the flow chamber, and applying wash through a piping for conducting wash experiments.

In Figure 19, the two left images under lower-speed washing, EPS-expressing E. coli cells (red fluorescence indicated by white arrows) maintained adhesion to the glass surface for an extended period without being dislodged, while the control group (green fluorescence) was washed away. In the two right images, subjecting adherent E. coli to more intense washing removed non-adherent cells completely. However, EPS-expressing E. coli cells (white arrows) could still adhere to the glass surface for a considerable time. This indicates that EPS effectly promotes E. coli adhesion.

Figure 19. Fluorescence Microscopy Imaging (150x) of E.coli Adhesion
All four images were captured from the same field of view, showing E.coli adhesion under different washing conditions. The two images on the left depict bacterial adhesion over an extended period under mild washing, while the two images on the right show bacterial adhesion still remains under stronger washing.

In the following video, we further demonstrated the adhesion process of EPS-expressing E. coli cells (red fulorescence indicated by white arrows) during the aforementioned washing procedures.

Figure 20: Visualization of E.coli Adhesion through Fluorescence Microscopy
Magnification: 150x
Fluoresence images were captured with 200ms interval

These results collectively affirm that EPS effectively mediates E. coli adhesion to surfaces, thereby enhancing the terraforming process.

5. Software Validation

This year, we developed a software tool (opens new window) for quantitatively design ribozyme-assisted polycistronic co-expression system. We also performed experimental validation for our software, as shown in BBa_K4765129 (opens new window).

We inserted different stem-loops between stayGold and Twister P1, and compared the red-green fluorescence intensity ratio to assess the stem-loop's ability to prevent mRNA degradation.

Figure 21: Biobricks in BBa_K4765129.
BBa_K765129 includes promoter, stayGold, Twister P1 (self-cleaving ribozyme), mScarlet, and terminator.

:::Stem-loops nsl: no stem-loop liu2023: natural occurred, described previously (opens new window) new2/6/10 & old6/10: stem-loops designed by our software with different free energy change of reaction

nsl:     5-AAACACCCACCACAAUUUCCACCGUUU UUUGU-3
liu2023: 5-AAACACCCACCACAAUUUCCACCGUUU CCCGACGCUUCGGCGUCGGG UUUGU-3
new2:    5-AAACACCCACCACAAUUUCCACCGUUU CCCCGUCGGCUGCU UUUGU-3
new6:    5-AAACACCCACCACAAUUUCCACCGUUU AGACGCUCGGCGUCCU UUUGU-3
new10:   5-AAACACCCACCACAAUUUCCACCGUUU ACUGGGGGGAUCGAGGUCUUU UUUGU-3
old6:    5-AAACACCCACCACAAUUUCCACCGUUU AGACGCUCGGCGUCCU UUUGU-3
old10:   5-AAACACCCACCACAAUUUCCACCGUUU GGCGGCGCUACAGCGUCGU UUUGU-3

:::

Our experimental findings unveiled a clear connection: as the change in free energy (ΔG) within the reaction decreases, mRNA stability increases, resulting in a higher GFP/RFP ratio. In summary, designing stem-loops with lower ΔG values enhances their ability to shield mRNA from degradation.

Figure 22: The relationship between the free enegy of stem-loop and GFP/OD and RFP/OD.
Bacteria were cultured without IPTG, both GFP and RFP signal were driven by the T7 leaky promoter. In cells with higher leaky, stronger RFP/OD were observed. RFP signal is from the mScarlet CDS before T7 terminator, which uses the stem-loop structure formed by the terminator, and is most stable. We suggest to put the CDS needed most at the last position.

Figure 23: The relationship between the free enegy of stem-loop and mRNA degradation rate.

In summary, the four Survival, Symbiotic, Biofilm Formation and Terraforming Systems for our biofilm, all have been made and test. All performed as designed. Having them together in one bacteria will be our choice of terraforming space explorer - B.HOME v1 (BBa_K4765140 (opens new window)). We are also in the process of using shuttle test (BBa_K4765130 (opens new window)) to empower cyanobacteria with Anti-UV Module, Anti-Freeze Module and Anti-Desiccation capabilities.

The composite part BBa_K4765129 (opens new window) represents a novel strategy to employ 3' stem-loops for regulating mRNA stability and targeted protein levels, especially during polycistronic experssion. It also provides opportunity to examine various natural occurring stem-loops sequences from sequencing databases, and could be a useful tool to uncover novel RNA regulation mechanisms.